Upload
Featured Recent Articles Topics Login Upload

Search Results for 'alignment gene'

alignment gene published presentations and documents on DocSlides.

Dynamic Programming II Gene Prediction: Similarity-Based Approaches
Dynamic Programming II Gene Prediction: Similarity-Based Approaches
by finley
The idea of similarity-based approach to gene pred...
MCB 3421 Class 13 Multiple sequence alignment
MCB 3421 Class 13 Multiple sequence alignment
by sadie
the role of gene duplication followed by loss of f...
Alternative splicing: Sequence Alignment
Alternative splicing: Sequence Alignment
by walsh
with . Affine . Gap. Erin Howell. Alternative Spli...
Introduction to Phylogenomics
Introduction to Phylogenomics
by SweetiePie
and . Metagenomics. Tandy Warnow. The Department o...
Dynamic Programming II
Dynamic Programming II
by mitsue-stanley
Dynamic Programming II Gene Prediction: Similari...
Introduction to RNA- seq
Introduction to RNA- seq
by trish-goza
Joel Parker, Ph.D.. LCCC Biomedical Informatics. ...
Bacteriophage Gene Functions
Bacteriophage Gene Functions
by natalia-silvester
Welkin Pope. SEA-PHAGES Bioinformatics Workshop, ...
Stubbs Lab Bioinformatics –
Stubbs Lab Bioinformatics –
by karlyn-bohler
5. Review . tophat. , alignment summary and . hts...
BIO 508
BIO 508
by phoebe-click
Comparative Genomics. Eric Franzosa, PhD. 2 April...
Phylogenomics Symposium
Phylogenomics Symposium
by conchita-marotz
and Software School. Tandy Warnow. Departments of...
RNA- seq data analysis:
RNA- seq data analysis:
by olivia
transcriptome. assembly and differential express...
CS/BIOE 598:
CS/BIOE 598:
by phoebe-click
Algorithmic Computational Genomics. Tandy Warnow....
Common Errors in
Common Errors in
by calandra-battersby
Student Annotation Submissions. contributions fro...
Input:
Input:
by trish-goza
Alignment.. Model parameters from neutral sequenc...
Common Errors in
Common Errors in
by lindy-dunigan
Student Annotation Submissions. contributions fro...
RNA-seq: Quantifying the Transcriptome
RNA-seq: Quantifying the Transcriptome
by karlyn-bohler
Alisha Holloway, PhD. Gladstone Bioinformatics Co...
Chalk Talk
Chalk Talk
by yoshiko-marsland
Tandy Warnow. Departments of Computer Science and...
Genome curation guide Empowering the Medfly community by Alexie Papanicolaou, Monica
Genome curation guide Empowering the Medfly community by Alexie Papanicolaou, Monica
by lois-ondreau
Genome curation guide Empowering the Medfly com...
CS/BIOE 598: Algorithmic Computational Genomics
CS/BIOE 598: Algorithmic Computational Genomics
by provingintel
Tandy Warnow. Departments of Bioengineering and Co...
Conservation in Evolution
Conservation in Evolution
by cozync
-HOX genes -Vestigial structure...
UPR - Department of Biology
UPR - Department of Biology
by cadie
College of Natural Resource. Río Piedras Campus. ...
Use of in silico algorithms for variant interpretation
Use of in silico algorithms for variant interpretation
by MommaBear
ACMG/AMP Variant . Interpretation . guidelines . (...
Supertrees and the Tree of Life
Supertrees and the Tree of Life
by test
Tandy Warnow. The University of Texas at Austin. ...
Previous Lecture:
Previous Lecture:
by liane-varnes
Gene Expression . Next-Generation . DNA Sequencin...
TGCAAACTCAAACTCTTTTGTTGTTCTTACTGTATCATTGCCCAGAATAT
TGCAAACTCAAACTCTTTTGTTGTTCTTACTGTATCATTGCCCAGAATAT
by luanne-stotts
TCTGCCTGTCTTTAGAGGCTAATACATTGATTAGTGAATTCCAATGGGC...
Mapping NGS sequences to a reference genome
Mapping NGS sequences to a reference genome
by debby-jeon
Why?. Resequencing. studies (DNA). Structural va...
Last lecture summary
Last lecture summary
by briana-ranney
Sequencing strategies. Hierarchical genome shotgu...
Genomics and Personalized Care in Health Systems
Genomics and Personalized Care in Health Systems
by lois-ondreau
Lecture 5 Genome Browser. Leming Zhou, PhD. Schoo...
Ensembl
Ensembl
by lois-ondreau
. RNASeq. Pipeline. Steve Searle. Outline of Ta...
TGCAAACTCAAACTCTTTTGTTGTTCTTACTGTATCATTGCCCAGAATAT
TGCAAACTCAAACTCTTTTGTTGTTCTTACTGTATCATTGCCCAGAATAT
by olivia-moreira
TCTGCCTGTCTTTAGAGGCTAATACATTGATTAGTGAATTCCAATGGGC...
Introduction to RNA-
Introduction to RNA-
by olivia-moreira
Seq. . and Transcriptome Analysis. Hands – on ...
http://cs273a.stanford.edu [BejeranoFall14/15]
http://cs273a.stanford.edu [BejeranoFall14/15]
by sherrill-nordquist
1. MW  . 12:50-2:05pm . in Beckman . B100. Profs...
Profile HMMs
Profile HMMs
by pamella-moone
Tandy Warnow. BioE. /CS 598AGB. Profile Hidden Ma...
Comparative genomics
Comparative genomics
by olivia-moreira
Joachim Bargsten. February 2012. Comparative . ge...
Evolution of toxin-antitoxin systems in
Evolution of toxin-antitoxin systems in
by enjoinsamsung
Streptococcus . bacteria. Sarah Cook. Carnegie Mel...
http://cs273a.stanford.edu [BejeranoFall15/16]
http://cs273a.stanford.edu [BejeranoFall15/16]
by impristic
1. MW  . 1:30-2:50pm . in . Clark . S361*. (behi...
Last lecture summary Sequencing strategies
Last lecture summary Sequencing strategies
by vivian
Hierarchical genome shotgun HGS – Human Genome P...
October 09 CSE 182 CSE182-
October 09 CSE 182 CSE182-
by lydia
L8. Protein Sequence Analysis . Patterns (regular ...
CSE182- L8 Protein domain analysis via
CSE182- L8 Protein domain analysis via
by QuietConfidence
HMMs. Gene finding. April 16. Regular expressions ...
Comparative genomics Joachim Bargsten
Comparative genomics Joachim Bargsten
by molly
February 2012. Comparative . genomics. The study o...